Mark Collier briefed me on two updates under embargo at KubeCon Europe 2026 last month: Helion, which opens up GPU kernel ...
At the core of these advancements lies the concept of tokenization — a fundamental process that dictates how user inputs are interpreted, processed and ultimately billed. Understanding tokenization is ...
Stop letting AI pick your passwords. They follow predictable patterns instead of being truly random, making them easy for ...
The financially motivated cybercriminal threat actor Storm-1175 operates high-velocity ransomware campaigns that weaponize ...
Meta pauses Mercor partnership after a major data breach raises concerns over exposure of sensitive AI training data.
Background/aims Ocular surface infections remain a major cause of visual loss worldwide, yet diagnosis often relies on slow ...
AI firm Anthropic accidentally leaked its Claude Code source code via an npm package, revealing unreleased features like an ...
For over two decades in the HR industry, I have witnessed the shifts and changes in how organizations identify and secure talent. The transition from handwritten applications to digital resumes was ...
Claude, the AI model from Anthropic, was asked to generate a short video, which has since gone viral for its brilliantly ...
Python 3.15 introduces an immutable or ‘frozen’ dictionary that is useful in places ordinary dicts can’t be used.
What does it take to govern a technology that might reshape the world within the decade? Answering that requires both big-picture thinking about where AI is heading and close engagement with the ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...